From 688ffc1dc1d4706074cdd876c6f064e2c7d03c54 Mon Sep 17 00:00:00 2001 From: Russ Cox Date: Fri, 20 Nov 2009 08:59:11 -0800 Subject: [PATCH] test/bench revisions; * reverse-complement: port C algorithm to Go saves 30% on my MacBook Pro and makes it a fairer comparison. * test reverse-complement with and without GC (another 15%) * revise timing.sh to work on more systems * avoid two glibcisms in fasta.c R=r https://golang.org/cl/156110 --- test/bench/fasta.c | 10 +++--- test/bench/reverse-complement.go | 54 +++++++++++++++++++------------- test/bench/timing.sh | 10 ++++-- 3 files changed, 46 insertions(+), 28 deletions(-) diff --git a/test/bench/fasta.c b/test/bench/fasta.c index 9cd7f25c2f..65f4d3d35d 100644 --- a/test/bench/fasta.c +++ b/test/bench/fasta.c @@ -82,7 +82,7 @@ static void repeat_fasta (char const *s, size_t count) { memcpy (s2 + len, s, WIDTH); do { size_t line = MIN(WIDTH, count); - fwrite_unlocked (s2 + pos,1,line,stdout); + fwrite (s2 + pos,1,line,stdout); putchar_unlocked ('\n'); pos += line; if (pos >= len) pos -= len; @@ -113,7 +113,7 @@ static void random_fasta (aminoacid_t const *genelist, size_t count) { buf[pos++] = genelist[i].c; } while (pos < line); buf[line] = '\n'; - fwrite_unlocked (buf, 1, line + 1, stdout); + fwrite (buf, 1, line + 1, stdout); count -= line; } while (count); } @@ -163,11 +163,11 @@ GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; - fputs_unlocked (">ONE Homo sapiens alu\n", stdout); + fputs (">ONE Homo sapiens alu\n", stdout); repeat_fasta (alu, 2 * n); - fputs_unlocked (">TWO IUB ambiguity codes\n", stdout); + fputs (">TWO IUB ambiguity codes\n", stdout); random_fasta (iub, 3 * n); - fputs_unlocked (">THREE Homo sapiens frequency\n", stdout); + fputs (">THREE Homo sapiens frequency\n", stdout); random_fasta (homosapiens, 5 * n); return 0; } diff --git a/test/bench/reverse-complement.go b/test/bench/reverse-complement.go index a7ea8afbd6..a7c7d71394 100644 --- a/test/bench/reverse-complement.go +++ b/test/bench/reverse-complement.go @@ -92,29 +92,41 @@ func output(buf []byte) { func main() { in = bufio.NewReader(os.Stdin); - buf := make([]byte, 100*1024); - top := 0; - for { - line, err := in.ReadSlice('\n'); - if err != nil { - break - } - if line[0] == '>' { - if top > 0 { - output(buf[0:top]); - top = 0; + buf := make([]byte, 1024*1024); + line, err := in.ReadSlice('\n'); + for err == nil { + os.Stdout.Write(line); + + // Accumulate reversed complement in buf[w:] + nchar := 0; + w := len(buf); + for { + line, err = in.ReadSlice('\n'); + if err != nil || line[0] == '>' { + break; + } + line = line[0:len(line)-1]; + nchar += len(line); + if len(line)+nchar/60+128 >= w { + nbuf := make([]byte, len(buf)*5); + copy(nbuf[len(nbuf)-len(buf):len(nbuf)], buf); + w += len(nbuf) - len(buf); + buf = nbuf; + } + for r := 0; r < len(line); r++ { + w--; + buf[w] = complement[line[r]]; } - os.Stdout.Write(line); - continue; } - line = line[0 : len(line)-1]; // drop newline - if top+len(line) > len(buf) { - nbuf := make([]byte, 2*len(buf)+1024*(100+len(line))); - copy(nbuf, buf[0:top]); - buf = nbuf; + + // Copy down to beginning of buffer, inserting newlines. + // The loop left room for the newlines and 128 bytes of padding. + i := 0; + for j := w; j < len(buf); j += 60 { + n := copy(buf[i:i+60], buf[j:len(buf)]); + buf[i+n] = '\n'; + i += n+1; } - copy(buf[top:len(buf)], line); - top += len(line); + os.Stdout.Write(buf[0:i]); } - output(buf[0:top]); } diff --git a/test/bench/timing.sh b/test/bench/timing.sh index 0c3e49bf38..7c3eeab8e1 100755 --- a/test/bench/timing.sh +++ b/test/bench/timing.sh @@ -1,4 +1,4 @@ -#!/bin/sh +#!/usr/bin/env bash # Copyright 2009 The Go Authors. All rights reserved. # Use of this source code is governed by a BSD-style # license that can be found in the LICENSE file. @@ -59,7 +59,8 @@ run() { echo -n ' '$1' ' $1 shift - (/home/r/plan9/bin/time $* 2>&1 >/dev/null) | sed 's/r.*/r/' + + echo $((time -p $* >/dev/null) 2>&1) | awk '{print $4 "u " $6 "s " $2 "r"}' } fasta() { @@ -78,6 +79,11 @@ revcomp() { run 'gccgo -O2 reverse-complement.go' a.out < x run 'gc reverse-complement' $O.out < x run 'gc_B reverse-complement' $O.out < x + export GOGC=off + runonly echo 'GOGC=off' + run 'gc reverse-complement' $O.out < x + run 'gc_B reverse-complement' $O.out < x + unset GOGC rm x } -- 2.51.0